The Tetrahedron Constellation Gravitational Wave Observatory would consist of four satellites positioned in space ...
CNW/ - Coveo (TSX: CVO), the market leader in AI-Relevance — delivering AI-search, generative, and business-aware relevance ...
The exam will be held on March 20. To ace it, candidates must comprehensively understand the MP TET Varg 2 Syllabus and Exam Pattern. The syllabus of MP TET Varg 2 exam focuses on subject-specific ...
Briefly, the CRISPR/Cas9 expression vectors, which expressed Cas9, sgRNA (GGCACATACAGCCATCATGA) and puromycin resistant gene, was constructed based on the pX330 vector (YSY BIOTECH, CHINA).
Please note that your conversations will be recorded.
Some results have been hidden because they may be inaccessible to you
Show inaccessible results
Feedback